Hack my Cancer - grip krijgen op je kanker door Andrew Evans

Artikelen over oogmelanoom

Hack my Cancer - grip krijgen op je kanker door Andrew Evans

Berichtdoor marti » ma 29 jan 2018, 13:31

Kanker biologie voor patiënten - deel 1 is verschenen op de FB pagina voor oogmelanoom.

https://medium.com/hack-my-cancer/kanke ... -voor-patiënten-deel-1-2c63dac368e7

Vertaling van het persoonlijk verslag van Andrew Evans, bio-informaticus, vertaald door Bianca Oei. Grip krijgen op de ziekte kanker. Vertaling goedgekeurd door Andrew Evans.

Dit bericht is voor mensen die net als ik in een situatie zitten waarin je meer wilt weten over de ziekte en de regie in handen kunt houden. Niet iedereen wil achterover leunen en het allemaal maar laten gebeuren. Soms willen mensen meedenken met de behandeling, en om meer over de ziekte kanker te weten kunnen we het beste ons verdiepen in wat de ziekte nou eigenlijk is en hoe dit kan ontstaan. Met deze wetenschap kunnen wij beter communiceren met ons team van artsen. Op die manier kunnen we samen met de artsen naar andere opties, waaronder verbeterde behandel-opties kijken.
Om dit te kunnen doen moeten we terug naar de tijd toen we biologie kregen op school. In dit bericht ga ik het ook hebben over de biologie van de tegenstander: (de kanker) Wij zouden ons deze begrippen meester moeten maken, en indien nodig herhalen tot het begrepen wordt. Dit maakt het mogelijk om grip te krijgen op de situatie en met de artsen over behandelingen te kunnen spreken.
Kanker is je eigen kwaadaardig-veranderde tweeling Het eerste wat belangrijk is om te begrijpen dat de kanker van jezelf is. Wat ik bedoel met dit: Het is je eigen lichaam wat zich tegen jezelf keert. Dit is de kern waarom kanker zich duivelachtig presenteert en hierdoor moeilijk te herkennen en behandelen is. Hier komen we later nog op terug.
Eerst een uitleg over waaruit we bestaan. Als de kanker een deel van jezelf is, dan moeten wij beschrijven waaruit jezelf bestaat.
We bestaan allemaal uit cellen. Elke cel is het kleinste onderdeel van een levend iets-. Wij bestaan uit een gigantische kolonie van cellen welke samenwerken en gespecialiseerde taken hebben om, door een rolverdeling, een functioneel geheel te vormen. Het is net zoals een groot bedrijf met verschillende afdelingen vol met gespecialiseerde onderdelen, die samenwerken om het geheel goed te laten functioneren. Ieder cel in ons lichaam is — tot op zekere hoogte- een onafhankelijke levend iets. Dit is waarom wij ook cellen uit een lichaam kunnen verwijderen en ze onafhankelijk kunnen laten groeien in een schaaltje, zelfs als ze niet meer verbonden zijn met ons lichaam. Iedere individuele cel in het lichaam draagt alle informatie met zich mee om zijn taak te vervullen, zichzelf in stand te houden en te onderhouden. Maar hier komt het opmerkelijk — niet alleen kan iedere cel zijn eigen instructies uit de handleiding uitvoeren, verder draagt iedere cel ook alle informatie over de andere cellen. Feitelijk, een kopie van alle informatie vanuit de basis-cel staat ‘beschreven’ in iedere cel van je lichaam.
Laten wij even stilstaan om goed deze enorme impact van dit gegeven te laten inwerken: Iedereen begint als een enkele cel (moeder’s bevruchte eicel), welke zich individueel deelt, steeds maar weer totdat er letterlijk triljoenen cellen zijn die ieder onderdeel van je lichaam vormen. Terwijl de cellen zich delen en je lichaam zich verder gaat ontwikkelen, verschillende ’schakelaars’ uit en aan gezet worden volgens de instructie in deze cellen, zodat ze zich kunnen ontwikkelen tot gespecialiseerde groepen ( zoals huid, zenuwen, botten, spieren, etc). Dit gehele proces op zich noemt men differentiatie. Maar zelfs bij iedere verschillende delen van instructies waar de schakelaars zijn aan/uit gezet in de verschillende soorten cellen, draagt iedere cel een volledige kopie van de instructies.
DNA is de taal van het leven.
In elke cel van het lichaam zit informatie, geschreven in een chemische taal -dit noemen we DNA. in elk lichaam is de DNA uniek. De DNA instructies binnen in iedere cel lijkt op een bibliotheek van boeken welke ieder aspect beschrijven over hoe de cellen werken en zich verzamelen in verschillende lichaamsweefsels. Deze boeken noemen wij genen en deze bevatten specifieke instructies om de chemische reserve onderdelen te maken welke gebruikt worden om cellen op te bouwen, omgeven door structuren eromheen, helpen signalen naar elkaar af te geven, etc. Er zijn ruwweg 20.000 genen in ieders individuele DNA.
Als wij 1 typische cel van een lichaam nemen en naar het DNA kijken, vinden wij enkele karakteristieke eigenschappen. Het DNA is opgebouwd uit 46 chemische moleculen; genoemd chromosomen, deze chromosomen verschijnen in paren- dus iedereen heeft 23 paren chromosomen. Ieder chromosoom is een lange snoer van andere, kleinere chemische bestanddelen, genoemd basis- samen geschikt als een snoer van kralen. Deze bestaan uit alleen vier basissen, welke wij onderscheiden met de letters “A, ”C”, ”G, en “T”. Dit zijn de eerste letters van hun wetenschappelijke namen. Dus- iedereen kan deze letters zien als een simpel DNA alfabet — alles in het DNA wordt gespeld met deze letters. Genen zijn als opvolgende paragrafen, geschreven met lange snoeren van bases, binnen het grotere snoer van een chromosoom. Hieronder is een voorbeeld van de actuele code van een van de kortste gen in mensen:

GACCACGTGGCCTAATGGATAAGGCGTCTGACTTCGGATCAGAAGATTGAGGGTTCGAATCCCTTCGTGGTTA

Dit zegt ons misschien niet zoveel, maar dit is echt belangrijke informatie voor onze cellen. Het vertelt ze hoe een kleine maar heel belangrijke reserve onderdeel kunnen maken genoemd een tRNA. Genen variëren nogal in lengte, maar van dit is een voorbeeld van een klein gen, er bestaan genen welke duizenden letters lang zijn.
En, is iedereen nog bij de les tot nu toe ? Hieronder volgt een korte herhaling:
Iedereen bestaat uit triljoenen cellen
Iedere cel draagt alle instructies om ieder onderdeel van je lichaam te maken in de vorm van een DNA code
Deze code is opgeborgen in chemische groep snoeren genoemd chromosomen
Deze code is opgebouwd uit 4 symbolen die wij A,C,G en T noemen
Snoeren van deze symbolen vormen de blauwdruk om reserveonderdelen voor cellen te maken.
Nu hebben we het bovenstaande besproken en ik hoor jullie denken “maar we zouden het toch hebben over kanker ?”
Welnu, beste lezer — kanker gaat over over (veranderd) DNA.
Of meer in het bijzonder, DNA dat verandert naar sommige specifieke manieren. Dus om kanker te begrijpen, moet je eerst een basiskennis krijgen over ons DNA, en hoe dit in balans wordt gehouden en gereguleerd wordt in een gezond werkende cel. Omdat kanker ontstaat wanneer de balans doorslaat naar een juiste (of misschien verkeerde) manier…
Dus: hier stoppen wij even om iedereen de tijd te geven om deze belangrijke basale informatie op te nemen.
Vragen tot zover ? Vraag ze in de vragenbus hieronder. De volgende sessie gaan wij doornemen over het Rube Goldberg mechanisme binnen in de cel dat ons levend en gezond houdt, en hoe beschadigd DNA dit kan veranderen en je cellen in staat stellen boosaardig te veranderen.
marti
 
Berichten: 210
Geregistreerd: zo 06 maart 2011, 10:03

Keer terug naar Artikelen over oogmelanoom

Wie is er online

Gebruikers op dit forum: Geen geregistreerde gebruikers. en 1 gast