Hack my Cancer - grip krijgen op je kanker door Andrew Evans

Artikelen over oogmelanoom

Hack my Cancer - grip krijgen op je kanker door Andrew Evans

Berichtdoor marti » ma 29 jan 2018, 13:31

Kanker biologie voor patiënten - deel 1 is verschenen op de FB pagina voor oogmelanoom.

https://medium.com/hack-my-cancer/kanke ... -voor-patiënten-deel-1-2c63dac368e7

Vertaling van het persoonlijk verslag van Andrew Evans, bio-informaticus, vertaald door Bianca Oei. Grip krijgen op de ziekte kanker. Vertaling goedgekeurd door Andrew Evans.

Dit bericht is voor mensen die net als ik in een situatie zitten waarin je meer wilt weten over de ziekte en de regie in handen kunt houden. Niet iedereen wil achterover leunen en het allemaal maar laten gebeuren. Soms willen mensen meedenken met de behandeling, en om meer over de ziekte kanker te weten kunnen we het beste ons verdiepen in wat de ziekte nou eigenlijk is en hoe dit kan ontstaan. Met deze wetenschap kunnen wij beter communiceren met ons team van artsen. Op die manier kunnen we samen met de artsen naar andere opties, waaronder verbeterde behandel-opties kijken.
Om dit te kunnen doen moeten we terug naar de tijd toen we biologie kregen op school. In dit bericht ga ik het ook hebben over de biologie van de tegenstander: (de kanker) Wij zouden ons deze begrippen meester moeten maken, en indien nodig herhalen tot het begrepen wordt. Dit maakt het mogelijk om grip te krijgen op de situatie en met de artsen over behandelingen te kunnen spreken.
Kanker is je eigen kwaadaardig-veranderde tweeling Het eerste wat belangrijk is om te begrijpen dat de kanker van jezelf is. Wat ik bedoel met dit: Het is je eigen lichaam wat zich tegen jezelf keert. Dit is de kern waarom kanker zich duivelachtig presenteert en hierdoor moeilijk te herkennen en behandelen is. Hier komen we later nog op terug.
Eerst een uitleg over waaruit we bestaan. Als de kanker een deel van jezelf is, dan moeten wij beschrijven waaruit jezelf bestaat.
We bestaan allemaal uit cellen. Elke cel is het kleinste onderdeel van een levend iets-. Wij bestaan uit een gigantische kolonie van cellen welke samenwerken en gespecialiseerde taken hebben om, door een rolverdeling, een functioneel geheel te vormen. Het is net zoals een groot bedrijf met verschillende afdelingen vol met gespecialiseerde onderdelen, die samenwerken om het geheel goed te laten functioneren. Ieder cel in ons lichaam is — tot op zekere hoogte- een onafhankelijke levend iets. Dit is waarom wij ook cellen uit een lichaam kunnen verwijderen en ze onafhankelijk kunnen laten groeien in een schaaltje, zelfs als ze niet meer verbonden zijn met ons lichaam. Iedere individuele cel in het lichaam draagt alle informatie met zich mee om zijn taak te vervullen, zichzelf in stand te houden en te onderhouden. Maar hier komt het opmerkelijk — niet alleen kan iedere cel zijn eigen instructies uit de handleiding uitvoeren, verder draagt iedere cel ook alle informatie over de andere cellen. Feitelijk, een kopie van alle informatie vanuit de basis-cel staat ‘beschreven’ in iedere cel van je lichaam.
Laten wij even stilstaan om goed deze enorme impact van dit gegeven te laten inwerken: Iedereen begint als een enkele cel (moeder’s bevruchte eicel), welke zich individueel deelt, steeds maar weer totdat er letterlijk triljoenen cellen zijn die ieder onderdeel van je lichaam vormen. Terwijl de cellen zich delen en je lichaam zich verder gaat ontwikkelen, verschillende ’schakelaars’ uit en aan gezet worden volgens de instructie in deze cellen, zodat ze zich kunnen ontwikkelen tot gespecialiseerde groepen ( zoals huid, zenuwen, botten, spieren, etc). Dit gehele proces op zich noemt men differentiatie. Maar zelfs bij iedere verschillende delen van instructies waar de schakelaars zijn aan/uit gezet in de verschillende soorten cellen, draagt iedere cel een volledige kopie van de instructies.
DNA is de taal van het leven.
In elke cel van het lichaam zit informatie, geschreven in een chemische taal -dit noemen we DNA. in elk lichaam is de DNA uniek. De DNA instructies binnen in iedere cel lijkt op een bibliotheek van boeken welke ieder aspect beschrijven over hoe de cellen werken en zich verzamelen in verschillende lichaamsweefsels. Deze boeken noemen wij genen en deze bevatten specifieke instructies om de chemische reserve onderdelen te maken welke gebruikt worden om cellen op te bouwen, omgeven door structuren eromheen, helpen signalen naar elkaar af te geven, etc. Er zijn ruwweg 20.000 genen in ieders individuele DNA.
Als wij 1 typische cel van een lichaam nemen en naar het DNA kijken, vinden wij enkele karakteristieke eigenschappen. Het DNA is opgebouwd uit 46 chemische moleculen; genoemd chromosomen, deze chromosomen verschijnen in paren- dus iedereen heeft 23 paren chromosomen. Ieder chromosoom is een lange snoer van andere, kleinere chemische bestanddelen, genoemd basis- samen geschikt als een snoer van kralen. Deze bestaan uit alleen vier basissen, welke wij onderscheiden met de letters “A, ”C”, ”G, en “T”. Dit zijn de eerste letters van hun wetenschappelijke namen. Dus- iedereen kan deze letters zien als een simpel DNA alfabet — alles in het DNA wordt gespeld met deze letters. Genen zijn als opvolgende paragrafen, geschreven met lange snoeren van bases, binnen het grotere snoer van een chromosoom. Hieronder is een voorbeeld van de actuele code van een van de kortste gen in mensen:

GACCACGTGGCCTAATGGATAAGGCGTCTGACTTCGGATCAGAAGATTGAGGGTTCGAATCCCTTCGTGGTTA

Dit zegt ons misschien niet zoveel, maar dit is echt belangrijke informatie voor onze cellen. Het vertelt ze hoe een kleine maar heel belangrijke reserve onderdeel kunnen maken genoemd een tRNA. Genen variëren nogal in lengte, maar van dit is een voorbeeld van een klein gen, er bestaan genen welke duizenden letters lang zijn.
En, is iedereen nog bij de les tot nu toe ? Hieronder volgt een korte herhaling:
Iedereen bestaat uit triljoenen cellen
Iedere cel draagt alle instructies om ieder onderdeel van je lichaam te maken in de vorm van een DNA code
Deze code is opgeborgen in chemische groep snoeren genoemd chromosomen
Deze code is opgebouwd uit 4 symbolen die wij A,C,G en T noemen
Snoeren van deze symbolen vormen de blauwdruk om reserveonderdelen voor cellen te maken.
Nu hebben we het bovenstaande besproken en ik hoor jullie denken “maar we zouden het toch hebben over kanker ?”
Welnu, beste lezer — kanker gaat over over (veranderd) DNA.
Of meer in het bijzonder, DNA dat verandert naar sommige specifieke manieren. Dus om kanker te begrijpen, moet je eerst een basiskennis krijgen over ons DNA, en hoe dit in balans wordt gehouden en gereguleerd wordt in een gezond werkende cel. Omdat kanker ontstaat wanneer de balans doorslaat naar een juiste (of misschien verkeerde) manier…
Dus: hier stoppen wij even om iedereen de tijd te geven om deze belangrijke basale informatie op te nemen.
Vragen tot zover ? Vraag ze in de vragenbus hieronder. De volgende sessie gaan wij doornemen over het Rube Goldberg mechanisme binnen in de cel dat ons levend en gezond houdt, en hoe beschadigd DNA dit kan veranderen en je cellen in staat stellen boosaardig te veranderen.
marti
 
Berichten: 206
Geregistreerd: zo 06 maart 2011, 10:03

Re: Hack my Cancer - grip krijgen op je kanker door Andrew E

Berichtdoor marti » ma 29 jan 2018, 13:35

Deel 2 Hack my Cancer- vertaling door Bianca nog in afwachting van goedkeuring door Andrew Evans

Welkom terug, Cancer Hackers, we starten met een goed begrip over de basisbegrippen die wij nodig hebben om de genetische testen te begrijpen, verdere reguliere therapieën, alternatieve en dieet therapieën en hoe wij de kanker te lijf moeten gaan. Wij verlaten deel 1 ( eventueel kun je dit nog even nalezen) met de kennis van het belangrijkste deel: kanker is een ziekte van het DNA. Vandaag gaan wij verder de diepte in, zodat je kunt begrijpen waarom beschadigd DNA kan leiden tot de biologische ramp, die wij kanker noemen.
En nu een woord over je Genoom.
De laatste keer spraken wij uitgebreid over het feit dat ons lichaam een complete kopie draagt van alle DNA instructies van iedere cel in ons lichaam. Een complete kopie van deze instructies (= alle DNA codes van onze genen welke wij hebben geërfd van onze moeder en vader) heet ons persoonlijke genoom. Ieder van ons heeft een persoonlijke genoom. Jouw persoonlijke genoom maakt ons biologisch verschillend van alle anderen, of wij vrouw of man zijn, blond of bruin haar hebben, klein of groot zijn, risico’s hebben op het ontstaan van ziekte enz enz. Het is jouw DNA geschiedenis, dat ontstaat vanuit onze familie en jouw biologische lot beïnvloedt.
Als wij een willekeurige keuze maken uit verschillende personen uit een willekeurige stad, komen wij uit op een groep mensen die ogenschijnlijk genetisch totaal verschillend lijken. De realiteit is, dat hun DNA waarschijnlijk 99% identiek is. Er bestaat een enorme overeenkomst omdat een overgroot deel van het DNA maakt dat onze cellen functioneren als dieren, verdere differentiatie tot zoogdieren. Deze groepen hebben allemaal ruwweg dezelfde DNA code. Meestal worden grote veranderingen in dit DNA niet toegelaten, omdat dit DNA zoveel zou verstoren en ons zou doden. Dus het basis DNA blijft hetzelfde omdat het door de miljoenen jaren van de biologische evolutie heeft heen geloodst. Dit deel van onze DNA code is hoog geconserveerd.
Er zijn ongeveer 3 miljard codes (instructies) in het menselijke genoom. Stel je voor een boek met 3 miljard bladzijden. Uit deze 3 miljard bladzijden, zijn alleen ongeveer 3 miljoen posities van deze codes per individu verschillend. (Dat is ongeveer 0,1%). We praten nu steeds over dezelfde 3 miljoen bladzijden van het boek. Probeer je voor te stellen dezelfde groep mensen die wij lukraak kozen in de vorige alinea: Ieder heeft een boek met 3 miljard bladzijden, die als wij het boek doornemen, bijna allemaal gelijk zijn behalve bijvoorbeeld hoofdstuk 13, de 33e paragraaf, tweede lijn, vijfde woord. – datzelfde woord heeft misschien een schrijffoutje in 1 woord, of komt vaker voor dan in de boeken van de anderen. Deze spelfoutjes, zijn niet lukraak geplaatst in het boek van ons genoom- verre van dat. Dit zijn de specifieke variaties in de genetische code, en deze specifieke variaties in de genetische code hebben bewezen nuttig te zijn op de een of andere manier en deze juist hebben geloodst door de evolutie-geschiedenis, alhoewel zij soms het in zich hebben om te ruilen (is het niet altijd zo?)
Deze een letterige variaties zijn de presentatie van juist een soort verandering welke kan optreden binnen het DNA en deze variatie beïnvloedt de functie. Wij kunnen ook toevoegingen of hiaten krijgen in het DNA (vergelijk het met knippen, kopiëren, plakken van foutjes); het nummer van de kopie kan variëren (wanneer delen van DNA worden herhaald) en zelfs zaken zoals extra of juiste missende kopieën van het totale chromosoom. Soms breken delen van het chromosoom af, of worden geplakt op een ander chromosoom, wat zaken kan vertroebelen. Vergelijk dit met een kookboek waarin het recept voor een gerecht als: ‘ Aubergine met Parmezaanse kaas’, per ongeluk de ingrediënten worden geplaatst in een ander gerecht, zoals ‘kip-salade’. Tja, beide gerechten zijn dan anders dan het originele recept. Deze gebeurtenis noemt men een translocatie. Je kunt je voorstellen dat sommige van deze variaties meer of mindere consequenties hebben dan andere.
Zoals ik zei, sommige van deze variaties zijn normaal en een natuurlijke gebeurtenis binnen ons genoom. Voor de meesten van ons hebben de meeste van deze variaties geen directe grote consequenties Sommige echter – zoals de zeldzame varianten welke bij voorbeeld cysteuze fibrose of sikkel cell anaemie veroorzaken-, zijn minder goedaardig. Dit zijn DNA veranderingen waarin functie van de cellen zo wijzigt dat deze veranderingen ons (ernstig )ziek maken.

Wij kunnen deze variaties erven van moeder en/of vader, waarbij zij aanwezig zijn in ieder kopie van ons genoom in iedere cel van ons lichaam, of – en dit is belangrijk – DNA binnen jouw cellen kunnen beschadigen in het verloop van je leven.
En dit brengt ons terug naar kanker. Kanker is een ziekte van beschadigd DNA. Voor de meesten van ons ontstond de kanker in sommige DNA cellen, soms zelfs 1 cel , door een reeds ongelukkige gebeurtenissen- welke geleid hebben tot de ontwikkeling van kanker. Wanneer je dit inzicht hebt, helpt dit je om veel zaken, waar de artsen over spreken, te begrijpen. De test resultaten en de soorten klinische trials waarvoor jij geschikt zou zijn, worden meer inzichtelijk. Maar blijf nog even doorlezen, voor verdere begripsvorming hebben wij nog een lange weg te gaan. In de volgende les gaan wij hier verder op in, en zullen bespreken wat precies nodig is om te weten welke beschadiging ten grondslag ligt aan het voorkomen van kanker en hoe dit kan ontstaan.
OK; vorige keer heb ik gezegd dat wij gaan praten over de Rube Goldberg machines. Nou ja, ik ben hier nog niet aan toegekomen deze keer – ik wilde eerst dieper ingaan op het DNA, dus moeten wij dit uitstellen tot een volgende keer waarin wij ingaan op dit mooie zijdelingse artikel.
Iedereen heeft een genoom en iedere cel in ons lichaam heeft een volledige kopie hiervan. Wij zijn genetische bijna identiek tot elkaar- het verschil tussen ons en anderen ligt in de genoemde 0,1%.
Het deel wat verschillend is – is onderhevig aan veranderingen (mutaties) welke een natuurlijke oorsprong hebben in de evolutionaire geschiedenis.
DNA (variaties) verschillen van persoon tot persoon, kunnen goedaardig zijn of juist een ziekte veroorzaken ( maar de meeste variaties zijn goedaardig)
Wanneer het DNA beschadigt (breekt) nadat wij geboren zijn en zich ontwikkelt, kan dit kanker veroorzaken.
Deze soort variatie onderscheidt zich van het geërfde materiaal juist omdat het niet geërfd is maar verworven ( hé nu komen wij ergens), en deze variatie is niet te vinden in iedere cel in je lichaam, maar alleen in het betrokken materiaal.

Dit was het voor deze keer, - veel om in je op te nemen. De volgende keer gaan wij verder graven in het begrip kanker. (Hoera!)
marti
 
Berichten: 206
Geregistreerd: zo 06 maart 2011, 10:03

Re: Hack my Cancer - grip krijgen op je kanker door Andrew E

Berichtdoor marti » ma 29 jan 2018, 13:36

Kankerbiologie deel 3 Vertaling door Bianca nog in afwachting van goedkeuring Andrew Evans:

Uitspraak:

“Personen wie niet zijn opgeleid in chemie of medicijnen realiseren zich mogelijk niet hoe moeilijk het probleem van kankertherapie werkelijk is. Het is bijna- niet precies, maar bijna – zo moeilijk als het vinden van een middel dat een linkeroor oplost, maar het rechteroor onaangetast laat. Zo minimaal is het verschil tussen een kankercel en zijn normale voorgangercel”
Uitspraak van:
William H.Woglom, pionier in kankeronderzoek (1947)
OK, deze keer gaan we dieper in op bijzonderheden van kankergenetica. Had ik dit al eerder gezegd: kanker is een ziekte is van beschadigd DNA ? Inderdaad, het is de moeite van het opnieuw benoemen waard. In deze episode gaan wij exact zien hoe dit werkt om op te staan tegen kanker. Dit is een heel belangrijk deel, dus wij nemen er de tijd voor om het helder op een rijtje te krijgen.


Een opeenvolgende reeks van ongelukkige gebeurtenissen:
We hebben niet veel gesproken over de actuele karakteristieken van kanker, en waarom het zo kwaadaardig is. Allereerst moet je je realiseren ( zoals ik besprak in Deel 1) is dat kanker zich tegen jezelf keert. Wat ik hiermee bedoel is dat kankercellen je eigen lichaamscellen zijn die zo beschadigd zijn dat zij gevaarlijk worden. Het feit dat ze nog steeds jouw cellen zijn maakt het duivels moeilijk om ze te bestrijden. (Dat was het punt dat William Woglom maakte in zijn uitspraak hierboven). Kankercellen volgen de nieuwe DNA instructie die op belangrijke punten verschillen dan de DNA instructies waarmee je geboren bent. In de meeste gevallen worden de grote problemen veroorzaakt doordat deze cellen zich oncontroleerbaar gaan delen en uitgroeien tot een massa wat wij tumoren noemen. Deze tumoren stelen niet alleen voedingsmiddelen uit je lichaam, ze nemen de ruimte in van normaal weefsel, sluiten normaal weefsel af en veroorzaken hierdoor chaos. Als de kanker toeneemt, kan het zich verder veranderen om nog ergere schade te brengen door bijvoorbeeld het zenden van valse signalen om optimaal tot snelle groei aan te zetten of sporen andere weefsels aan meer voedsel te geven aan de tumor door zichzelf te vernietigen ten gunste van de tumorgroei. (Dit proces noem je cachexie) Kanker kan zich ook nog wijzigen gedurende therapie, die eerst goed lijkt te werken, maar dan niet meer werkzaam is. Kanker is evolutie in de hoogste versnelling.
Allereerst: Hoe kunnen genen breken (beschadigen)?. Het is een gevaarlijke wereld hier – er zijn vele oorzaken welke DNA kunnen beschadigen, eigenlijk wordt ook jouw DNA doorlopend beschadigd. DNA vijanden zijn: UV licht (zoals ontstaat bij zonnebrand), sommige chemicaliën (zoals ontstaan in de rook van sigaretten, zelfs van de barbecue ) , chronisch alcohol gebruik en nucleaire straling (inclusief de soms hoog energetische kosmische straling uit de ruimte). Zelfs bij normale proces van kopiëren van DNA, kunnen bij celdeling onregelmatigheden ontstaan. Het is eigenlijk onmogelijk om geen DNA schade op te lopen (alhoewel je stappen kunt ondernemen dit te minimaliseren- door bijvoorbeeld Sun block te gebruiken). Het is zo dat wij een ingebouwd DNA reparatiecentrum hebben, en in de meeste gevallen doen deze centra hun werk uitstekend. Als je DNA niet meer gerepareerd kan worden, dan bestaat er een ingebouwde ‘zelfmoord’instructie die in werking treedt en de cel zichzelf vernietigd (dit proces noem je apoptose), zodat dit geen verwoestende schade veroorzaakt.
Maar soms wordt het DNA reparatie centrum overspoeld door zoveel fouten, dat een foutje wat de potentie in zich heeft om problemen te veroorzaken als het niet wordt gerepareerd of zichzelf vernietigd, niet gerepareerd wordt. In het algemeen kan 1 DNA foutje hier of daar niet leiden tot het vormen van kanker. Vaak blijft zelfs het foutje onopgemerkt voor jaren- tot aan tientallen jaren, terwijl de gemuteerde cel- en zijn nakomelingen - stil wachten op een volgende gebeurtenis.

Voor het ontwikkelen van kanker zijn er tenminste 2 soorten genen die gebroken/beschadigd nodig.-Normale genen welke voor controleerbare celdeling van de cellen zorgen , tenzij beschadigd dan worden zij (proto-onco genen) en genen die ongecontroleerde deling stoppen -tenzij beschadigd (dit noem je tumor onderdrukkende genen). Er is een grote variatie van ieder van deze genen, omdat er vele manieren (wegen) zijn die kunnen aanzetten tot ongecontroleerde celdeling aanzetten, en ook vele manieren (wegen) zijn die deze aanzetting kunnen onderdrukken. Deze hebben allen verschillende paden (pathways) waarbinnen de oncogenen en de tumorgroei onderdrukkende genen bewegende onderdelen zijn (en onthoudt dat paden (pathways) vaak veel bewegende delen hebben). Maar de kern van dit verhaal is – Meestal zijn minstens twee ongelukkige gebeurtenissen nodig – een gebroken proto-oncogeen en een gebroken tumor onderdrukkende gen- welke leiden tot de ontwikkeling van kanker. Je kunt het zien als: een oncogeen zet aan tot een versnelling- een tumor onderdrukker gen werkt als een rem- Voorbeeld: een auto: de versneller geeft vol gas, en de remmen werken niet. Andere gebroken genen kunnen hier ook aan bijdragen- bijvoorbeeld er zijn genen die als ze op de juiste wijze gebroken zijn, de kanker zich laten verschuilen voor ons immuunsysteem (welke onze eerste lijn van bescherming is tegen tumor-ontwikkeling). Maar sinds de kanker over oncontroleerbare groei gaat, zijn deze eerste twee foute genen de sleutel tot de ontwikkeling van kanker. In het kankerresearch veld wordt hieraan gerefereerd als de twee-hit of soms de multi-hit hypothese.
Wanneer de DNA beschadiging ontstaat in een cel die deze beschadiging overleeft, is er een kans dat meer DNA beschadigingen ontstaan- dit komt omdat het DNA ‘geklutst’ kan worden met delen van een chromosoom en per ongeluk ‘geplakt’ gaat worden aan andere, en het chromosoom zijn structuur verliest- hierdoor ontrafelt, of juist gebroken wordt in meer delen wanneer de cel zich deelt, en deze op hun beurt verkeerd aan elkaar plakken. Het is een soort DNA kookkunst daarbinnen, en deze snelle mutatie spoort aan tot de snelle evolutie tot een meer (kwaadaardiger) verschijning van kanker. Wanneer een chromosoom zo is beschadigd dat het niet meer correct kan deelnemen aan kopiëren en celdeling, kan het ‘verloren ’gaan – in andere woorden, één van de gedeelde cellen krijgt een totaal onvolledige kopie, dus alle nakomelingen erven hierdoor DNA met het ontbrekend chromosoom. Wij hebben twee kopieën van ieder chromosoom ( behalve de mannen wie een X en Y hebben vrouwen hebben XX), als wij een chromsoom paar verliezen, hebben wij nog maar ‘ 1 back-up kopie’ over. Als er iets gebeurt met onze genen, hebben wij nog een ‘goede’ kopie om over te nemen.

Om een voorbeeld te geven van mijn eigen ziekte , uvea-melanoom- Er bestaat een tumor onderdrukkend gen genaamd BAP1 dat zich bevindt op de korte arm van chromosoom 3. Een vorm van deze kanker toont meestal een verlies van juist 1 werkende kopie (monosomie) van chromosoom 3. Daarmee heb je dus maar 1 werkende kopie van BAP1. Als er maar iets gebeurt met de overgebleven kopie van chromosoom 3, dan is er niets wat de tumorgroei kan stoppen ( er vanuit gaande dat een proto-oncogeen ook ergens schade heeft opgelopen). Het verlies van BAP1 is een verschrikkelijke omwenteling in de ontwikkeling in uvea-melanoom, welke wordt geassocieerd met slechtere prognose. Ondertussen gaat het verlies van de functionerende tumor onderdrukker BAP1 vaak samen met een abnormale extra kopie van de q arm (de lange arm) van chromosoom 8. Dit is significant omdat een echt sterke proto-oncogeen genoemd MYC zich op chromosoom 8 bevindt. Dus als wij op beide plaatste getroffen worden: verlies van een tumor onderdrukkend gen, en versterking van een proto-onco gen -versnellend- ( welke zich heeft gemuteerd in een volledig oncogeen op dit punt - -dit is eigenlijk meer als een 3-hit gebeurtenis) De kanker (oncogeen) versie van MYC (genoemd c-MYC) onderdrukt de controle van celdeling, zoals wij eigen verwachten van een oncogen.

Samenvattend:
• Kanker is wanneer jouw cellen zich keren zich tegen jou, deze evolutie gaat snel voorwaarts, en resulteert in ongecontroleerde celgroei;
• DNA wordt steeds beschadigd, maar wordt meestal gerepareerd – kanker gebeurt wanneer dit niet wordt gerepareerd;
• Kanker is afhankelijk van jouw breuken in je DNA in tenminste twee exacte dezelfde locaties – een proto-oncogeen (versneller) en een tumor onderdrukkend gen;
• Oncogenen gedragen zich als versnellers – tumor supressors (onderdrukkers) gedragen zich als remmen;
• Er zijn heel veel van deze genen en ze variëren uitgebreid voor de verschillende kankersoorten;
• Soms komt de eerste aanval (hit) en houdt zich stil voor jaren of tientallen jaren voordat de volgende aanval (2-hit) verschijnt.
In de volgende aflevering gaan wij zien wat er gebeurt wanneer de kanker beslist zich te gaan spreiden- een proces wij wat uitzaaiingen -of metastasen noemen.
marti
 
Berichten: 206
Geregistreerd: zo 06 maart 2011, 10:03


Keer terug naar Artikelen over oogmelanoom

Wie is er online

Gebruikers op dit forum: Geen geregistreerde gebruikers. en 1 gast